***Free Shipping worldwide***

DNAjewel Story

WE ARE BUILT ON A FOUNDATION OF LOVE FOR ANIMALS

Our love for animals inspired us to search for a way to attract our spirit animal's energy to our lives in a non-offensive way.

The solution we found was to produce wild animal's DNA in an innovative way, not harming or touching the animal.

DNA is made up of molecules called nucleotides. Each nucleotide contains a phosphate group, a sugar group, and a nitrogen base.

The four types of nitrogen bases are adenine (A), thymine (T), guanine (G) and cytosine (C).

The specific order of these bases throughout the animal genome is what makes each animal species unique.

For example, a part of an elephant DNA sequence will look like that:

CTTCCATTCATAATTTCCTATGATGCACCTCAAACAACTTCCTGGACGGGGATCCCAGCTAAATATAGCC
GTTTCTCTGTCTTACAACACAGGCTCCGGTATATAAATCAGGCAAATTCCCCGTTTGAGCATGAACCTCT

GAAAAGTGCCGGCATCTAAGGTCTCCTCCAAGGCCCTCTGCAGTCCAGCCC.

Those "letters" are the bases of the spiral DNA as most of the people know it.

Since DNA is a chemical molecule, it can be synthesized in a lab from the four building blocks, resulting in a DNA molecule which has the exact same chemical properties as a DNA molecule purified from a living cell.

In collaboration with IDT  (IDT, is one of the leading DNA/RNA synthesis manufacturers in the world and have been synthesizing high-quality synthetic DNA since 1992) and Syntezza Bioscience we chose a sequence shown using bioinformatics tools to be one of the sequences which differentiate the wolf species from other animal species.

After identifying this unique sequence, IDT manufactured the DNA sequence synthetically.

The result is identical to genuine DNA and has the animal's characteristics, attributes, and energy.

Then after we have done we insert it into a designed jewelry, making it wearable 24/7, so you can feel your spirit animal's energy close to your heart.

This way we are protecting the animals and enjoying their energy and attributes at the same time.

DNAjewel is the original and official store offering the most unique jewelry ever.